| Sequence ID | >SRA1047797 |
| Genome ID | SRR035094.43172 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 129 |
| End posion on genome | 201 |
| Amino Acid | Ile |
| Anticodon | TAT |
| Upstream region at tRNA start position |
ttattagtgc |
| tRNA gene sequence |
GGGCGTGTAGCTCAGTTGGCAGAGCATTGGTCTTATACACCAACGGTCGGGGGTTCAAGT |
| Downstream region at tRNA end position |
actttctttt |
| Secondary structure (Cloverleaf model) | >SRA1047797 Ile TAT
c Attc actttctttt
G - C
G - C
G - C
C - G
G - C
T T
G + T T G
T C C T C C A
T G A A | | + | | A
T C T C G G G G G G C
G | | | | T T
G G A G C
C A A CGGTC
T - A
T - A
G - C
G - C
T - A
C C
T A
T A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |