| Sequence ID | >SRA1047851 |
| Genome ID | SRR035094.54860 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 118 |
| End posion on genome | 192 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
aattttaaaa |
| tRNA gene sequence |
GCGGGAATAGCTCAGTTGGCTAGAGCGTCAGCCTTCCAAGCTGAGGGTCGCGGGTTCGAA |
| Downstream region at tRNA end position |
attattattt |
| Secondary structure (Cloverleaf model) | >SRA1047851 Gly TCC
a TCtt attattattt
G - C
C - G
G - C
G - C
G - C
A - T
A - T C A
T T G C C C A
T G A A + | | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
C T A G GGGTC
T - A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |