| Sequence ID | >SRA1047854 |
| Genome ID | SRR035094.55104 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 207 |
| End posion on genome | 132 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
attgcttatt |
| tRNA gene sequence |
CGGGGCGTGGCGCAGCCTGGTTAGCGCGCCTGAATGGGGTTCAGGAGGTCGGGAGTTCGA |
| Downstream region at tRNA end position |
aaattggaag |
| Secondary structure (Cloverleaf model) | >SRA1047854 Pro GGG
t ACtg aaattggaag
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T C C C T C A
C C G A G | | | | | G
T C G C G G G G A G C
G | | | | T T
G G C G C
T T A G AGGTC
C - G
C - G
T - A
G - C
A - T
A T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |