Sequence ID | >SRA1047952 |
Genome ID | SRR035094.74967 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 329 |
End posion on genome | 404 |
Amino Acid | Sup |
Anticodon | CTA |
Upstream region at tRNA start position |
tcacaactat |
tRNA gene sequence |
GAGAGCTTAGCTCAGCTGGTAGAGCGCCGATTTCTAAACTCGGATGTCGAGGGTTCGAGC |
Downstream region at tRNA end position |
attattaatt |
Secondary structure (Cloverleaf model) | >SRA1047952 Sup CTA t TCTA attattaatt G - C A - T G - C A - T G + T C - G T - A C G T T T C C C A C G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A G ATGTC C - G C - G G - C A - T T C T A T A C T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |