Sequence ID | >SRA1048103 |
Genome ID | SRR035094.109187 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 315 |
End posion on genome | 240 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgtactattc |
tRNA gene sequence |
AGCGGAGTGGAGCAGTCAGGAGTGCTCGCAGGGCTCATAACCCTGAGGTCGGAGGTTCAA |
Downstream region at tRNA end position |
tttcaataat |
Secondary structure (Cloverleaf model) | >SRA1048103 Met CAT c ACtt tttcaataat A - T G - C C - G G - C G - C A - T G - C T A T T C T C C A C T G A G + | | | | A A C G A G G G A G G C G | | | | T T G G C T C A G T G AGGTC C - G A - T G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |