Sequence ID | >SRA1048123 |
Genome ID | SRR035094.112985 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 107 |
End posion on genome | 34 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cccgacttaa |
tRNA gene sequence |
GCGGGGCTAGTTGATCGGTTCAACATCACCCTTCCAAGGTGAAAAGATGGGTTCGACTCC |
Downstream region at tRNA end position |
gagacaataa |
Secondary structure (Cloverleaf model) | >SRA1048123 Gly TCC a TCTA gagacaataa G - C C - G G - C G - C G - C G - C C - G T C T T A C C C A T A A | | | | | G C G T T G A T G G G C G | | | | T T G C A A C T T A AAAG T - A C - G A - T C - G C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |