| Sequence ID | >SRA1048254 |
| Genome ID | SRR035094.135351 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 203 |
| End posion on genome | 292 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
cgtcgcaagc |
| tRNA gene sequence |
GGAGAGTTGGCCGAGTGGCTGAAGGCGCTGCCCTGCTAAGGCAGTATGGGGGAAACTCCA |
| Downstream region at tRNA end position |
tttttgtatc |
| Secondary structure (Cloverleaf model) | >SRA1048254 Ser GCT
c GCCA tttttgtatc
G - C
G - C
A - T
G - C
A - T
G - C
T - A T A
T G T C C C A
T G A G | | | | | G
G G C C G C A G G G C
G | | | T T
C A G G C
T G A G TATGGGGGAAACTCCATC
C - G
T - A
G - C
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |