Sequence ID | >SRA1048351 |
Genome ID | SRR035094.154142 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 175 |
End posion on genome | 249 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gcaattataa |
tRNA gene sequence |
GCGGGAGTAGTTCAGTGGTAGAACATCACCTTGCCAAGGTGGGGGTCGCGAGTTCAAACC |
Downstream region at tRNA end position |
tttttttagg |
Secondary structure (Cloverleaf model) | >SRA1048351 Gly GCC a TCAA tttttttagg G - C C - G G - C G - C G - C A - T G - C C A T T G C T C A G A A + | | | | A T C T T G G C G A G C G | | | | T T G G A A C T A A GGGTC T + G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |