Sequence ID | >SRA1048358 |
Genome ID | SRR035094.156092 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 218 |
End posion on genome | 292 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ctagaattag |
tRNA gene sequence |
GCCGTCTTAGCTCAGAGGTAGAGCAACTCCATGGTAAGGAGTAGGCCCGGGGTTCAATTC |
Downstream region at tRNA end position |
ttataatttt |
Secondary structure (Cloverleaf model) | >SRA1048358 Thr GGT g TCCA ttataatttt G - C C - G C - G G - C T - A C - G T - A T T T G C C C C A G A A | | | | | A A C T C G C G G G G C G | | | | T T G G A G C T A A AGGCC A - T C - G T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |