| Sequence ID | >SRA1048440 |
| Genome ID | SRR035094.174623 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 289 |
| End posion on genome | 215 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
tctatatctt |
| tRNA gene sequence |
GCCCCCATAGCTCAATGGATAGAGCACGGGACTTCTAATCCTGGGATAGGGGTTCAACTC |
| Downstream region at tRNA end position |
aacttatgat |
| Secondary structure (Cloverleaf model) | >SRA1048440 Arg TCT
t ACCG aacttatgat
G - C
C - G
C - G
C - G
C - G
C - G
A - T T C
T T C T C C A
T A A A | | + | | A
G C T C G A G G G G C
G | | | | T T
A G A G C
T A A GGAT
C - G
G + T
G - C
G - C
A - T
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |