Sequence ID | >SRA1048459 |
Genome ID | SRR035094.177396 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 143 |
End posion on genome | 56 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gttgcagtgc |
tRNA gene sequence |
GCCGGAGTGGCGGAATAGGTAGACGCACAGGACTTAAAATCCTGCGAGCTGTTAAGGTTC |
Downstream region at tRNA end position |
ataaaggtaa |
Secondary structure (Cloverleaf model) | >SRA1048459 Leu TAA c ACtt ataaaggtaa G - C C - G C - G G - C G - C A - T G - C T T T C G G C C A T A A G | | | | | G A G G C G G C C G G C G | | | T T G A C G C T A G A CGAGCTGTTAAGGTTCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |