Sequence ID | >SRA1048533 |
Genome ID | SRR035094.194685 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 428 |
End posion on genome | 516 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tggcactcta |
tRNA gene sequence |
GCCGAGATGGCGGAACTGGTAGACGCGCAGCCTTGAGGTGGCTGTGAGAATCAAATCTCG |
Downstream region at tRNA end position |
agaataaaaa |
Secondary structure (Cloverleaf model) | >SRA1048533 Leu GAG a ACAA agaataaaaa G - C C - G C - G G - C A - T G - C A - T T A T T C T C C A C A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C T A G G TGAGAATCAAATCTCGT C - G A - T G - C C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |