| Sequence ID | >SRA1048544 |
| Genome ID | SRR035094.196974 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 319 |
| End posion on genome | 398 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
agtgatagcG |
| tRNA gene sequence |
TCCCCCATCGTCTAGTCAGGTCCAGGACACTGGCCTTTCACGCCGGCAACACCGGTTCGA |
| Downstream region at tRNA end position |
Aacaattgnt |
| Secondary structure (Cloverleaf model) | >SRA1048544 Glu TTC
G CGCC Aacaattgnt
T - A
C - G
C - G
C - G
C - G
C - G
A - T T A
T T G G C C A
C T G A C | | | | | G
A T C T G A C C G G C
G + | | | T T
G G G A C
T C C A A CAAC
C - G
T + G
G - C
G - C
C - G
C C
T A
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |