| Sequence ID | >SRA1048574 |
| Genome ID | SRR035094.202081 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 163 |
| End posion on genome | 237 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
agtttttaat |
| tRNA gene sequence |
GCCGGCGTAGCTCAGTGGTAGAGCAACTGATTCGTAATCAGTAGGTCGCGGGTTCAACTC |
| Downstream region at tRNA end position |
gcaatatcaa |
| Secondary structure (Cloverleaf model) | >SRA1048574 Thr CGT
t TCCA gcaatatcaa
G - C
C - G
C - G
G - C
G - C
C - G
G - C T C
T T A C C C A
G A A + | | | A
T C T C G G C G G G C
G | | | | T T
G G A G C
T A A AGGTC
A - T
C - G
T - A
G - C
A - T
T A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |