Sequence ID | >SRA1048684 |
Genome ID | SRR035094.227588 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 50 |
End posion on genome | 120 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
agataaataa |
tRNA gene sequence |
GGGCCCATAGTCCAGTGGTAGAATACTTCCCTTGCACGGAAGAGATCCGCGTTCGATTCG |
Downstream region at tRNA end position |
taacaaataa |
Secondary structure (Cloverleaf model) | >SRA1048684 Ala TGC a Atat taacaaataa G - C G - C G + T C - G C - G C - G A - T T T T G G C G C A G A A | | | | | G T C C T G C C G C G C G | | + T T G G A A T T A A AGAT C - G T - A T - A C - G C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |