Sequence ID | >SRA1048804 |
Genome ID | SRR035094.253676 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 363 |
End posion on genome | 289 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tcaaatgcaa |
tRNA gene sequence |
GTCCCTGTAGCTCAGTGGATAGAGTGTCGGCCTCCGAAGCCGAAGGCGGGAGTTCGAGTC |
Downstream region at tRNA end position |
tgattgttca |
Secondary structure (Cloverleaf model) | >SRA1048804 Arg CCG a GCCT tgattgttca G - C T - A C - G C - G C - G T - A G - C T G T C C C T C A T G A A | | | | | G G C T C G G G G A G C G | | | + T T A G A G T T A G AGGC T - A C - G G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |