Sequence ID | >SRA1048878 |
Genome ID | SRR035094.271974 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 500 |
End posion on genome | 425 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atgccggagt |
tRNA gene sequence |
GGGCGCATAGCTCAGTTGGTAGAGCCACCGGCTCATAACCGGTCGGTCGTAGGTTCAAGT |
Downstream region at tRNA end position |
ctacaatcca |
Secondary structure (Cloverleaf model) | >SRA1048878 Met CAT t ACCA ctacaatcca G - C G - C G - C C - G G - C C - G A - T T G T C A T C C A T G A A | | | | | A T C T C G G T A G G C G | | | | T T G G A G C T A C CGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |