Sequence ID | >SRA1048881 |
Genome ID | SRR035094.272355 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 131 |
End posion on genome | 207 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
actaaatctt |
tRNA gene sequence |
GGGGGATTAGCTCAGTTGGCTAGAGCGCTAGATTTGCATTCTAGAGGTCAGGGGTTCGAC |
Downstream region at tRNA end position |
gaaaatggtt |
Secondary structure (Cloverleaf model) | >SRA1048881 Ala TGC t ACAA gaaaatggtt G - C G - C G + T G - C G + T A - T T - A T C T T C C C C A T G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C C T A G AGGTC C - G T - A A - T G - C A - T T T T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |