Sequence ID | >SRA1048888 |
Genome ID | SRR035094.276516 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001815) |
Species | |
Start position on genome | 99 |
End posion on genome | 175 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcagaaatag |
tRNA gene sequence |
GGTGGGATAGCTCAGTTGGTTAGAGCATGGGATTCATAAACCCAAGGTCGGCAGTTCGAT |
Downstream region at tRNA end position |
tatttttcaa |
Secondary structure (Cloverleaf model) | >SRA1048888 Met CAT g ACCA tatttttcaa G + T G - C T - A G - C G - C G - C A - T T T T C C G T C A T G A A | | | | | G T C T C G G G C A G C G | | | | T T G G A G C T T A A AGGTC T - A G - C G - C G - C A A T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |