| Sequence ID | >SRA1048900 |
| Genome ID | SRR035094.280192 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 286 |
| End posion on genome | 212 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
aaattttcag |
| tRNA gene sequence |
GGGCAAGTAGCTCAATGGCGGAGCACTCGGTTTACATCCGAGTGGTTACAGGTTCGAGTC |
| Downstream region at tRNA end position |
cttttttgcc |
| Secondary structure (Cloverleaf model) | >SRA1048900 Val TAC
g ACCA cttttttgcc
G - C
G - C
G - C
C - G
A - T
A - T
G - C T G
T T G T C C A
A A A | | | | | G
T C T C G A C A G G C
G | | | | T T
G G A G C
C G A TGGTT
C - G
T - A
C - G
G - C
G - C
T T
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |