| Sequence ID | >SRA1048985 |
| Genome ID | SRR035094.303828 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 371 |
| End posion on genome | 298 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
tttttaattt |
| tRNA gene sequence |
GGGCTCATAGCTCAGCTGGTAGAGCATCCGCCTTGCACGCGGAAGGTCGGGAGTTCGATC |
| Downstream region at tRNA end position |
tgctctttga |
| Secondary structure (Cloverleaf model) | >SRA1048985 Ala TGC
t ACtt tgctctttga
G - C
G - C
G + T
C - G
T - A
C - G
A - T C T
T C C C T C A
C G A A | | | | | G
T C T C G G G G A G C
G | | | | T T
G G A G C
T A A AGGTC
T - A
C - G
C - G
G - C
C - G
C C
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |