| Sequence ID | >SRA1049018 |
| Genome ID | SRR035094.315409 |
| Phylum/Class | 454 Sequencing (SRP001815) |
| Species | |
| Start position on genome | 104 |
| End posion on genome | 177 |
| Amino Acid | Ile |
| Anticodon | TAT |
| Upstream region at tRNA start position |
tgctagaccg |
| tRNA gene sequence |
GTTCTTGTAGCTCAGTTGGTTAGAGCGATGGTCTTATGAGCCATAGGTCGTGGGTTCAAC |
| Downstream region at tRNA end position |
cctttcatat |
| Secondary structure (Cloverleaf model) | >SRA1049018 Ile TAT
g Attt cctttcatat
G - C
T - A
T - A
C - G
T + G
T - A
G - C C C
T C A C C C A
T G A A | | | | | A
T C T C G G T G G G C
G | | | | T T
G G A G C
T T A G AGGTC
A - T
T - A
G - C
G - C
T + G
C A
T G
T A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |