Sequence ID | >SRA1049263 |
Genome ID | SRR035095.47534 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001816) |
Species | |
Start position on genome | 430 |
End posion on genome | 355 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatgatcaga |
tRNA gene sequence |
GGGCCCATAGCTCAGCTGGCAGAGCCACCGGCTCATAACCGGTAGGTCCCTGGTTCGAAA |
Downstream region at tRNA end position |
acacttagac |
Secondary structure (Cloverleaf model) | >SRA1049263 Met CAT a ACCA acacttagac G - C G - C G - C C - G C - G C - G A - T A A T G G A C C A C G A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C C A C AGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |