| Sequence ID | >SRA1049428 |
| Genome ID | SRR035095.76635 |
| Phylum/Class | 454 Sequencing (SRP001816) |
| Species | |
| Start position on genome | 258 |
| End posion on genome | 334 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
catcttttcc |
| tRNA gene sequence |
GGGCCCGTAGCTCAGTTGGTCAGAGCGGAGGACTCATAATCCTTTGGTCGTAGGTTCAAG |
| Downstream region at tRNA end position |
tcgctggcca |
| Secondary structure (Cloverleaf model) | >SRA1049428 Met CAT
c ACCT tcgctggcca
G - C
G - C
G - C
C - G
C - G
C - G
G - C T G
T C A T C C A
T G A A | | | | | A
T C T C G G T A G G C
G | | | | T T
G G A G C
T C A G TGGTC
G + T
A - T
G - C
G - C
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |