| Sequence ID | >SRA1050176 |
| Genome ID | SRR035095.206434 |
| Phylum/Class | 454 Sequencing (SRP001816) |
| Species | |
| Start position on genome | 202 |
| End posion on genome | 111 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
ttgccgttaa |
| tRNA gene sequence |
GGAGAGATGGCAGAGTGGTCGAATGCGGCGGTCTCGAAAACCGTTGTCCGTCGTAAGATG |
| Downstream region at tRNA end position |
cccgaaaatc |
| Secondary structure (Cloverleaf model) | >SRA1050176 Ser CGA
a GCCA cccgaaaatc
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T C C C C C A
T G A G | | | | | G
G G A C G G G G G G C
G | | | T T
T A T G C
C G A G TGTCCGTCGTAAGATGGACC
G + T
C - G
G - C
G - C
T - A
C A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |