Sequence ID | >SRA1050938 |
Genome ID | SRR035096.55174 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001817) |
Species | |
Start position on genome | 362 |
End posion on genome | 437 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
atacccatac |
tRNA gene sequence |
GCGCGAATAGCTCAGTTGGTAGAGCAACTCCTTTACACGGAGAAGGTCGGGAGTTCAAGT |
Downstream region at tRNA end position |
atcagccggc |
Secondary structure (Cloverleaf model) | >SRA1050938 Val TAC c ACCA atcagccggc G - C C - G G - C C - G G - C A - T A - T T G T C T C T C A T G A A | + | | | A T C T C G G G G A G C G | | | | T T G G A G C T A A AGGTC A A C - G T - A C - G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |