| Sequence ID | >SRA1050949 |
| Genome ID | SRR035096.57616 |
| Phylum/Class | 454 Sequencing (SRP001817) |
| Species | |
| Start position on genome | 168 |
| End posion on genome | 94 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
cgacagtgat |
| tRNA gene sequence |
GGCTCCGTAGCTTAACTGGATAAAGCACCGCACTACGGATGCGGAGATTCGGGGTTCGAA |
| Downstream region at tRNA end position |
gttaaaccct |
| Secondary structure (Cloverleaf model) | >SRA1050949 Arg ACG
t ACat gttaaaccct
G - C
G + T
C - G
T + G
C - G
C - G
G - C C A
T G T C C C A
C A A A | + | | | G
T T T C G C G G G G C
G | | | | T T
G A A G C
A T A A AGATT
C - G
C - G
G - C
C - G
A - T
C A
T G
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |