Sequence ID | >SRA1050982 |
Genome ID | SRR035096.65314 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001817) |
Species | |
Start position on genome | 273 |
End posion on genome | 201 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
atatagtgca |
tRNA gene sequence |
GGTCATGTGGCCTAATGGATAAGGCGTCCGCCTCCGGAGCGGGAGATTGTCAGTTCGAGT |
Downstream region at tRNA end position |
attcttttgt |
Secondary structure (Cloverleaf model) | >SRA1050982 Arg CCG a Aaaa attcttttgt G - C G + T T - A C - G A - T T T G - C T G T C A G T C A T A A G | | | | | G G T C C G G T C A G C G | | | | T T A A G G C T A G AGATT T + G C - G C - G G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |