Sequence ID | >SRA1051047 |
Genome ID | SRR035096.75217 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001817) |
Species | |
Start position on genome | 270 |
End posion on genome | 196 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gtcgtctaaT |
tRNA gene sequence |
GGTCTCGTGGCGCAACGGATAACGCGTCTGACTACGGATCAGAAGATTGCAGGTTCGAAT |
Downstream region at tRNA end position |
ttttttttca |
Secondary structure (Cloverleaf model) | >SRA1051047 Arg ACG T GAaa ttttttttca G - C G + T T - A C - G T - A C - G G - C T A T C G T C C A C A A G | | | | | G G C G C G G C A G G C G | | | T T A A C G C T A G AGATT T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |