| Sequence ID | >SRA1051158 |
| Genome ID | SRR035096.97959 |
| Phylum/Class | 454 Sequencing (SRP001817) |
| Species | |
| Start position on genome | 392 |
| End posion on genome | 308 |
| Amino Acid | Leu |
| Anticodon | CAG |
| Upstream region at tRNA start position |
aaccatcatt |
| tRNA gene sequence |
GCGCGGGTGGCGGAATTGGTAGACGCGCTGGCTTCAGGTGCCAGTGCCCGCAAGGGCGTA |
| Downstream region at tRNA end position |
aaaaatacgg |
| Secondary structure (Cloverleaf model) | >SRA1051158 Leu CAG
t ACag aaaaatacgg
G - C
C - G
G - C
C - G
G - C
G + T
G - C T G
T T C C C C A
T A A G | | | | | A
T G G C G A G G G G C
G | | | T T
G A C G C
T A G G TGCCCGCAAGGGCGT
C - G
T - A
G - C
G - C
C - G
T T
T G
C A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |