Sequence ID | >SRA1051210 |
Genome ID | SRR035096.110095 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001817) |
Species | |
Start position on genome | 127 |
End posion on genome | 51 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cgccctctac |
tRNA gene sequence |
GCGCCTGTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGCGGTCCCCCGTTCGAA |
Downstream region at tRNA end position |
aatttctcca |
Secondary structure (Cloverleaf model) | >SRA1051210 Arg ACG c ACCA aatttctcca G - C C - G G - C C - G C - G T - A G - C T A T G G G G C A C G A A | | | | | G T C T C G C C C C G C G | | | + T T G G A G T A T A A CGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |