Sequence ID | >SRA1051228 |
Genome ID | SRR035096.113105 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001817) |
Species | |
Start position on genome | 296 |
End posion on genome | 370 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
caaacaatgT |
tRNA gene sequence |
GCCGTGATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCTAAAGGTCCCCGGTTCGATC |
Downstream region at tRNA end position |
ataatatttt |
Secondary structure (Cloverleaf model) | >SRA1051228 Phe GAA T ATaa ataatatttt G - C C - G C - G G - C T + G G - C A - T C T T G G G C C A T G A A | | | | | G T C T C G C C C G G C G | | | | T T G G A G C G A G AGGTC T - A T - A A - T G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |