Sequence ID | >SRA1051425 |
Genome ID | SRR035096.175214 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001817) |
Species | |
Start position on genome | 128 |
End posion on genome | 55 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
taagtaacaa |
tRNA gene sequence |
GGGCGTGTGGCCTAATGGATAAGGCACCAGACTTCGGATCTGGGGGATTGCAGGTTCGAG |
Downstream region at tRNA end position |
taaatctttg |
Secondary structure (Cloverleaf model) | >SRA1051425 Arg TCG a Gaag taaatctttg G - C G + T G - C C - G G - C T - A G - C T G T T G T C C A T A A G + | | | | G G T C C G G C A G G C G | | | | T T A A G G C T A A GGGATT C - G C - G A - T G - C A - T C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |