| Sequence ID | >SRA1051625 |
| Genome ID | SRR035098.42023 |
| Phylum/Class | 454 Sequencing (SRP001819) |
| Species | |
| Start position on genome | 235 |
| End posion on genome | 308 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
ccaattttat |
| tRNA gene sequence |
GCGGCGTTAGTATAATGGTATTATGACAGCCTTCCAAGCTGATGACGCGGGTTCGATTCC |
| Downstream region at tRNA end position |
gttttaagta |
| Secondary structure (Cloverleaf model) | >SRA1051625 Gly TCC
t TCCA gttttaagta
G - C
C - G
G - C
G - C
C - G
G - C
T - A T T
T C G C C C A
A A A | | | | | G
T T A T G G C G G G C
G | | + T T
G T T A T
T A G TGAC
A A
C - G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |