Sequence ID | >SRA1051642 |
Genome ID | SRR035098.45474 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 103 |
End posion on genome | 190 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tcacttctag |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCTTCCGTTTCGAAAACGGATTGGGCGAAAGCCCTC |
Downstream region at tRNA end position |
aatcgcccgg |
Secondary structure (Cloverleaf model) | >SRA1051642 Ser CGA g GCAA aatcgcccgg G - C G - C A - T G - C G - C A - T T - A T C T C T C C C A T G A C | + | | | G G T C C G G G G G G C G | | | T T C T G G C C T A T TTGGGCGAAAGCCCTC T - A C - G C - G G - C T - A T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |