| Sequence ID | >SRA1051659 |
| Genome ID | SRR035098.51670 |
| Phylum/Class | 454 Sequencing (SRP001819) |
| Species | |
| Start position on genome | 66 |
| End posion on genome | 139 |
| Amino Acid | Trp |
| Anticodon | CCA |
| Upstream region at tRNA start position |
gcctcttctt |
| tRNA gene sequence |
GCGCCGTTAGTTCAGTTGGTAGAACGCAGGTCTCCAAAACCTGATGTCGGGGGTTCAAGT |
| Downstream region at tRNA end position |
gatgcccttt |
| Secondary structure (Cloverleaf model) | >SRA1051659 Trp CCA
t GCtc gatgcccttt
G - C
C - G
G - C
C - G
C - G
G - C
T - A T G
T C C T C C A
T G A A | | + | | A
T C T T G G G G G G C
G | | | | T T
G G A A C
T A G ATGTC
C - G
A - T
G - C
G - C
T - A
C A
T A
C C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |