Sequence ID | >SRA1051967 |
Genome ID | SRR035098.114835 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 118 |
End posion on genome | 194 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaagttata |
tRNA gene sequence |
GGGCCCATAGCTCAGTTGGTTAGAGCACTCGACTCATAATCGATCGGTCGCAGGTTCAAG |
Downstream region at tRNA end position |
aaaccttaaa |
Secondary structure (Cloverleaf model) | >SRA1051967 Met CAT a ACCA aaaccttaaa G - C G - C G - C C - G C - G C - G A - T T G T C G T C C A T G A A | | | | | A T C T C G G C A G G C G | | | | T T G G A G C T T A A CGGTC C T T - A C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |