Sequence ID | >SRA1052021 |
Genome ID | SRR035098.124591 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 211 |
End posion on genome | 138 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agttccattT |
tRNA gene sequence |
GCATCTGTGGCCGAGTGGTTAGGCACCGGACTCATAATCCGTTTTACACTGGTTCAAACC |
Downstream region at tRNA end position |
ctgaaattta |
Secondary structure (Cloverleaf model) | >SRA1052021 Met CAT T ATta ctgaaattta G - C C - G A - T T - A C - G T - A G - C C A T C G A C C A G A G | | | | A T G C C G A C T G G C G | | | T T G A G G C T T A TTTAC C T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |