Sequence ID | >SRA1052060 |
Genome ID | SRR035098.132384 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 214 |
End posion on genome | 139 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
attgtactgt |
tRNA gene sequence |
ACTCGGTTCGTCTAGTGGTCTAGGACATCACCCTTTCACGGTGGCTACAGGGGTTCAAAT |
Downstream region at tRNA end position |
tatagaaaca |
Secondary structure (Cloverleaf model) | >SRA1052060 Glu TTC t ACCA tatagaaaca A - T C - G T - A C - G G - C G - C T - A T A T T C C C C A T G A C | | | | | A G T C T G A G G G G C G + | | | T T T G G A C C T A A CTAC T + G C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |