Sequence ID | >SRA1052071 |
Genome ID | SRR035098.134298 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 273 |
End posion on genome | 349 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcacatcaga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
catttttagg |
Secondary structure (Cloverleaf model) | >SRA1052071 Met CAT a ACCA catttttagg C A G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | + | | | A C C G A G G T A G G C T | | | | T T G G C T C G C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |