Sequence ID | >SRA1052166 |
Genome ID | SRR035098.153692 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 3 |
End posion on genome | 78 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
nnnnnnnnat |
tRNA gene sequence |
GCGGGATTAGCTCAGTTGGTAGAGCGCGGTCTTTACACGGCTGATGTCGGCGGTTCGAAC |
Downstream region at tRNA end position |
atactgtagg |
Secondary structure (Cloverleaf model) | >SRA1052166 Val TAC t ACCA atactgtagg G - C C - G G - C G - C G - C A - T T - A C A T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A G ATGTC C - G G + T G - C T + G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |