Sequence ID | >SRA1052306 |
Genome ID | SRR035098.179110 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 225 |
End posion on genome | 152 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
accacgctac |
tRNA gene sequence |
GGGCTATTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCTCTGGTTCAAG |
Downstream region at tRNA end position |
cacgggggta |
Secondary structure (Cloverleaf model) | >SRA1052306 Ile GAT c Atgg cacgggggta G - C G - C G - C C - G T - A A - T T - A T G T A G A C C A G G A A | | | | | A T C T C G T C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |