Sequence ID | >SRA1052361 |
Genome ID | SRR035098.188616 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 312 |
End posion on genome | 387 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ctttcattaT |
tRNA gene sequence |
GGACAAGTAGCTCAGTTGGATAGAGTATGTGGCTACGAACTACAGTGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
tacagttgaa |
Secondary structure (Cloverleaf model) | >SRA1052361 Arg ACG T GTag tacagttgaa G + T G - C A - T C - G A - T A - T G - C T G T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | + T T G G A G T A T A A GTGTC T - A G - C T - A G + T G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |