Sequence ID | >SRA1052534 |
Genome ID | SRR035098.222300 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 224 |
End posion on genome | 150 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
aaccgtcttt |
tRNA gene sequence |
GATCCTGTAGCTCAATTGGTTAGAGCGTCGGTCTTATGAGCCGGAGGTTGTGGGTTCAAG |
Downstream region at tRNA end position |
ataaactatt |
Secondary structure (Cloverleaf model) | >SRA1052534 Ile TAT t ACtt ataaactatt G - C A - T T - A C - G C - G T + G G - C T G T T A C C C A T A A A + | | | | A T C T C G G T G G G C G | | | | T T G G A G C T T A G AGGTT T + G C - G G - C G - C T + G C A T G T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |