Sequence ID | >SRA1052873 |
Genome ID | SRR035098.289754 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 219 |
End posion on genome | 144 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cttttctatc |
tRNA gene sequence |
GCGGGCGTAACTCAACTGGTAGAGTGTCAGCCTTCCAAGCTGAATGTTGCGAGTTCGAGC |
Downstream region at tRNA end position |
tacaaactac |
Secondary structure (Cloverleaf model) | >SRA1052873 Gly TCC c TCAA tacaaactac G - C C - G G - C G - C G - C C - G G - C C G T T G C T C A C A A A + | | | | G T C T C A G C G A G C G | | | | T T G G A G T T A G ATGTT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |