Sequence ID | >SRA1052891 |
Genome ID | SRR035098.294637 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 92 |
End posion on genome | 167 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttcaggactt |
tRNA gene sequence |
AGGGCGGTGGCTCAATTGGTAGAGCAGCGGTCTCCAAAACCGCAGGTTGCAGGTTCGAGT |
Downstream region at tRNA end position |
cttcattgcg |
Secondary structure (Cloverleaf model) | >SRA1052891 Trp CCA t GCGA cttcattgcg A - T G - C G - C G - C C - G G - C G - C T G T T G T C C A T A A G + | | | | G T C T C G G C A G G C G | | | | T T G G A G C T A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |