Sequence ID | >SRA1052989 |
Genome ID | SRR035098.314849 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 21 |
End posion on genome | 97 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gtcaatatct |
tRNA gene sequence |
CGGGGTGTAGCGCAGCTCGGTAGCGTGCTTGCATGGGGTGTAAGAGGTCGTCGGTTCAAA |
Downstream region at tRNA end position |
agaagccagg |
Secondary structure (Cloverleaf model) | >SRA1052989 Pro GGG t ACCT agaagccagg C - G G - C G - C G - C G - C T - A G - C T A T C G G C C A C G A A | + | | | A T C G C G G T C G G C C | | | + T T G G C G T G T A G AGGTC C - G T - A T - A G + T C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |