Sequence ID | >SRA1053087 |
Genome ID | SRR035098.333647 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 104 |
End posion on genome | 33 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tctttgtgct |
tRNA gene sequence |
GCGGGTGTAGTTTAGTGGTAGAATACCTGCCTTCCAAGCAGGGGACGGGAGTTCGATTCT |
Downstream region at tRNA end position |
aaagcaaaag |
Secondary structure (Cloverleaf model) | >SRA1053087 Gly TCC t ACat aaagcaaaag G - C C - G G - C G - C G - C T - A G - C T T T C C C T C A G A A | | | | | G T T T T G G G G A G C G + | | + T T G G A A T T A A GGAC C - G C - G T - A G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |