Sequence ID | >SRA1053199 |
Genome ID | SRR035098.360431 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 225 |
End posion on genome | 144 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aaacgtaata |
tRNA gene sequence |
AGGTAGATGGCGAAATTGGTATACGCATCACACTCAAAATGTGACAATGAAAATTATGAG |
Downstream region at tRNA end position |
ctatataagt |
Secondary structure (Cloverleaf model) | >SRA1053199 Leu CAA a Aaat ctatataagt A - T G - C G - C T - A A - T G - C A - T T G T T T C C C A T A A G + | | | | G T A G C G G A G G G C G | | | T T G A C G C T A T A CAATGAAAATTAT T - A C - G A - T C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |