Sequence ID | >SRA1053207 |
Genome ID | SRR035098.361654 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001819) |
Species | |
Start position on genome | 166 |
End posion on genome | 91 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caaaatttat |
tRNA gene sequence |
TCCCTAGTAGCACAGAGGTAGTTGCGCTTCGCTGTTAACGAAGATGTCGTACGTTCGATC |
Downstream region at tRNA end position |
agtttatatg |
Secondary structure (Cloverleaf model) | >SRA1053207 Asn GTT t GCCA agtttatatg T - A C - G C - G C - G T + G A - T G - C C T T C A T G C A A G A A | | | | | G G C A C G G T A C G C G | | | T T T T T G C A G G ATGTC C - G T - A T - A C - G G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |